OA-986D
(Plasmid
#125001)
-
PurposeExpresses dCas9-VP64 driven by the Ubiquitin-63E promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 125001 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBac[3xP3-DsRed]
- Backbone size w/o insert (bp) 6457
- Total vector size (bp) 14513
-
Vector typeInsect Expression ; piggyback
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9-VP64
-
SpeciesSynthetic
-
Insert Size (bp)4875
- Promoter ubiquitin
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtcgacgatgtaggtcacggtctc
- 3′ sequencing primer GTCAACTTCAAAGTCCACGAGGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
OA-986D was a gift from Omar Akbari (Addgene plasmid # 125001 ; http://n2t.net/addgene:125001 ; RRID:Addgene_125001) -
For your References section:
Engineered reproductively isolated species drive reversible population replacement. Buchman A, Shriner I, Yang T, Liu J, Antoshechkin I, Marshall JM, Perry MW, Akbari OS. Nat Commun. 2021 Jun 2;12(1):3281. doi: 10.1038/s41467-021-23531-z. 10.1038/s41467-021-23531-z PubMed 34078888