pLAS3W-S100P
(Plasmid
#125009)
-
Purposeexpress in mammalian cell
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 125009 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLAS3w
- Backbone size w/o insert (bp) 9414
- Total vector size (bp) 9702
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameS100P
-
Alt nameMIG9
-
SpeciesH. sapiens (human)
-
Insert Size (bp)288
-
GenBank IDNM_005980.3, NM_005980
-
Entrez GeneS100P (a.k.a. MIG9)
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NHE1 (unknown if destroyed)
- 3′ cloning site ECOR1 (unknown if destroyed)
- 5′ sequencing primer gctggttattgtgctgtctcat (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLAS3W-S100P was a gift from Ruey-Hwa Chen (Addgene plasmid # 125009 ; http://n2t.net/addgene:125009 ; RRID:Addgene_125009) -
For your References section:
LncRNA NORAD is repressed by the YAP pathway and suppresses lung and breast cancer metastasis by sequestering S100P. Tan BS, Yang MC, Singh S, Chou YC, Chen HY, Wang MY, Wang YC, Chen RH. Oncogene. 2019 Jul;38(28):5612-5626. doi: 10.1038/s41388-019-0812-8. Epub 2019 Apr 9. 10.1038/s41388-019-0812-8 PubMed 30967631