pSBbi-Pur-AktAR2
(Plasmid
#125195)
-
PurposeSB-transposon plasmid for stable expression of AktAR2 variant of FRET-based AKT activity reporter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 125195 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSBbi-Pur
-
Backbone manufacturerAddgene plasmid # 60523
- Backbone size w/o insert (bp) 5661
-
Vector typeMammalian Expression ; Transposon
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAktAR2
-
SpeciesSynthetic
-
Insert Size (bp)2115
- Promoter EF1a/RPBSA
-
Tags
/ Fusion Proteins
- 6xHis, T7, and Xpress, mCerulean3 (N terminal on insert)
- cpVenus[E172] (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer GCCTCAGACAGTGGTTCAAAG
- 3′ sequencing primer AGGCACAGTCGAGGCTGAT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Not membrane-targeted. Insert subcloned from Addgene #64932.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBbi-Pur-AktAR2 was a gift from Eric Davis (Addgene plasmid # 125195 ; http://n2t.net/addgene:125195 ; RRID:Addgene_125195)