Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #125195)


Item Catalog # Description Quantity Price (USD)
Plasmid 125195 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Addgene plasmid # 60523
  • Backbone size w/o insert (bp) 5661
  • Vector type
    Mammalian Expression ; Transposon
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter EF1a/RPBSA
  • Tags / Fusion Proteins
    • 6xHis, T7, and Xpress, mCerulean3 (N terminal on insert)
    • cpVenus[E172] (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI (not destroyed)
  • 3′ cloning site SfiI (not destroyed)
  • 5′ sequencing primer GCCTCAGACAGTGGTTCAAAG
  • 3′ sequencing primer AGGCACAGTCGAGGCTGAT
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Not membrane-targeted. Insert subcloned from Addgene #64932.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSBbi-Pur-AktAR2 was a gift from Eric Davis (Addgene plasmid # 125195 ; ; RRID:Addgene_125195)