Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSBbi-Pur-AktAR2-D
(Plasmid #125196)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 125196 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSBbi-Pur
  • Backbone manufacturer
    Addgene plasmid # 60523
  • Backbone size w/o insert (bp) 5661
  • Vector type
    Mammalian Expression ; Transposon
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AktAR2-D
  • Species
    Synthetic
  • Insert Size (bp)
    2115
  • Mutation
    FoxO1 Thr-24 changed to Val rendering this inactive and unphosphorylatable
  • Promoter EF1a/RPBSA
  • Tags / Fusion Proteins
    • 6xHis, T7, and Xpress, mCerulean3 (N terminal on insert)
    • cpVenus[E172] (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI (not destroyed)
  • 3′ cloning site SfiI (not destroyed)
  • 5′ sequencing primer GCCTCAGACAGTGGTTCAAAG
  • 3′ sequencing primer AGGCACAGTCGAGGCTGAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Not membrane-targeted. Insert subcloned from Addgene #64932. This plasmid is almost identical to Addgene plasmid #125195 but has a single amino change in the target peptide.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSBbi-Pur-AktAR2-D was a gift from Eric Davis (Addgene plasmid # 125196 ; http://n2t.net/addgene:125196 ; RRID:Addgene_125196)