pSBbi-Pur-Lyn-AktAR2
(Plasmid
#125197)
-
PurposeSB-transposon plasmid for stable expression of lipid raft-targeted Lyn-AktAR2 variant of FRET-based AKT activity reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 125197 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSBbi-Pur
-
Backbone manufacturerAddgene plasmid # 60523
- Backbone size w/o insert (bp) 5661
-
Vector typeMammalian Expression ; Transposon
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLyn-AktAR2
-
SpeciesSynthetic
-
Insert Size (bp)2055
- Promoter EF1a/RPBSA
-
Tags
/ Fusion Proteins
- Lyn tag (GCIKSKRKD), mCerulean3 (N terminal on insert)
- cpVenus[E172] (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer GCCTCAGACAGTGGTTCAAAG
- 3′ sequencing primer AGGCACAGTCGAGGCTGAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Insert subcloned from Addgene plasmid #64932. Targeted to membrane by lipid raft-targeting peptide (GCIKSKRKD) derived from human kinase LYN.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBbi-Pur-Lyn-AktAR2 was a gift from Eric Davis (Addgene plasmid # 125197 ; http://n2t.net/addgene:125197 ; RRID:Addgene_125197) -
For your References section:
Tonic B-cell receptor signaling in diffuse large B-cell lymphoma. Havranek O, Xu J, Kohrer S, Wang Z, Becker L, Comer JM, Henderson J, Ma W, Man Chun Ma J, Westin JR, Ghosh D, Shinners N, Sun L, Yi AF, Karri AR, Burger JA, Zal T, Davis RE. Blood. 2017 Aug 24;130(8):995-1006. doi: 10.1182/blood-2016-10-747303. Epub 2017 Jun 23. 10.1182/blood-2016-10-747303 PubMed 28646116