Skip to main content
Addgene

pSBbi-Pur-Lyn-AktAR2-D
(Plasmid #125198)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 125198 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSBbi-Pur
  • Backbone manufacturer
    Addgene plasmid # 60523
  • Backbone size w/o insert (bp) 5661
  • Vector type
    Mammalian Expression ; Transposon
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lyn-AktAR2-D
  • Species
    Synthetic
  • Insert Size (bp)
    2055
  • Mutation
    FoxO1 Thr-24 changed to Val rendering this inactive and unphosphorylatable
  • Promoter EF1a/RPBSA
  • Tags / Fusion Proteins
    • Lyn tag (GCIKSKRKD), mCerulean3 (N terminal on insert)
    • cpVenus[E172] (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI (not destroyed)
  • 3′ cloning site SfiI (not destroyed)
  • 5′ sequencing primer GCCTCAGACAGTGGTTCAAAG
  • 3′ sequencing primer AGGCACAGTCGAGGCTGAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert subcloned from Addgene plasmid #64932. Targeted to membrane by lipid raft-targeting peptide (GCIKSKRKD) derived from human kinase LYN.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSBbi-Pur-Lyn-AktAR2-D was a gift from Eric Davis (Addgene plasmid # 125198 ; http://n2t.net/addgene:125198 ; RRID:Addgene_125198)
  • For your References section:

    Tonic B-cell receptor signaling in diffuse large B-cell lymphoma. Havranek O, Xu J, Kohrer S, Wang Z, Becker L, Comer JM, Henderson J, Ma W, Man Chun Ma J, Westin JR, Ghosh D, Shinners N, Sun L, Yi AF, Karri AR, Burger JA, Zal T, Davis RE. Blood. 2017 Aug 24;130(8):995-1006. doi: 10.1182/blood-2016-10-747303. Epub 2017 Jun 23. 10.1182/blood-2016-10-747303 PubMed 28646116