pSBbi-Pur-mCerulean3-spacer-cpVenus[E172]
(Plasmid
#125204)
-
PurposeSB-transposon plasmid for stable expression of mCerulean3-cpVenus[E172] FRET low control
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 125204 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSBbi-Pur
-
Backbone manufacturerAddgene plasmid # 60523
- Backbone size w/o insert (bp) 5661
-
Vector typeMammalian Expression ; Transposon
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCerulean3-spacer-cpVenus[E172]
-
SpeciesSynthetic
-
Insert Size (bp)2775
- Promoter EF1a/RPBSA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer GCCTCAGACAGTGGTTCAAAG
- 3′ sequencing primer AGGCACAGTCGAGGCTGAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Not membrane-targeted
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBbi-Pur-mCerulean3-spacer-cpVenus[E172] was a gift from Eric Davis (Addgene plasmid # 125204 ; http://n2t.net/addgene:125204 ; RRID:Addgene_125204) -
For your References section:
Tonic B-cell receptor signaling in diffuse large B-cell lymphoma. Havranek O, Xu J, Kohrer S, Wang Z, Becker L, Comer JM, Henderson J, Ma W, Man Chun Ma J, Westin JR, Ghosh D, Shinners N, Sun L, Yi AF, Karri AR, Burger JA, Zal T, Davis RE. Blood. 2017 Aug 24;130(8):995-1006. doi: 10.1182/blood-2016-10-747303. Epub 2017 Jun 23. 10.1182/blood-2016-10-747303 PubMed 28646116