Skip to main content

pCI-syn-fRGECO2
(Plasmid #125244)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 125244 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 125244-D50 50 μg of DNA in Tris buffer $495
DNA 125244-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCI
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 3684
  • Total vector size (bp) 5097
  • Modifications to backbone
    CMV promoter replaced by synapsin promoter
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    fRGECO2
  • Alt name
    jRGECO1a RS-1 EF-4
  • Species
    R. norvegicus (rat), G. gallus (chicken); Discosoma sp. (Sea anemone)
  • Insert Size (bp)
    1413
  • Mutation
    W44Y, D432A
  • Promoter synapsin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer TCCACCATGGTGCAGAACGAGCTTGCTCTTAAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene #61563

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

fRGECO2 is the W44Y and D432A variant of the jRGECO1a gene cloned from the pGP-CMV vector (#61563) published by Dana et al. 2016.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCI-syn-fRGECO2 was a gift from Katalin Torok (Addgene plasmid # 125244 ; http://n2t.net/addgene:125244 ; RRID:Addgene_125244)
  • For your References section:

    The kinetic mechanisms of fast-decay red-fluorescent genetically encoded calcium indicators. Kerruth S, Coates C, Durst CD, Oertner TG, Torok K. J Biol Chem. 2019 Mar 15;294(11):3934-3946. doi: 10.1074/jbc.RA118.004543. Epub 2019 Jan 16. 10.1074/jbc.RA118.004543 PubMed 30651353