Skip to main content

pTrcHis-7D12Gly42TAG
(Plasmid #125265)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 125265 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTrcHis
  • Backbone size w/o insert (bp) 4282
  • Total vector size (bp) 4702
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    7D12 Gly42 nanobody
  • Insert Size (bp)
    4702
  • Promoter trc promoter
  • Tag / Fusion Protein
    • His-tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gaggtatatattaatgtatcg
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTrcHis-7D12Gly42TAG was a gift from Angus Johnston (Addgene plasmid # 125265 ; http://n2t.net/addgene:125265 ; RRID:Addgene_125265)
  • For your References section:

    Pointing in the Right Direction: Controlling the Orientation of Proteins on Nanoparticles Improves Targeting Efficiency. Yong KW, Yuen D, Chen MZ, Porter CJH, Johnston APR. Nano Lett. 2019 Mar 13;19(3):1827-1831. doi: 10.1021/acs.nanolett.8b04916. Epub 2019 Feb 21. 10.1021/acs.nanolett.8b04916 PubMed 30773887