pSPgRNA_IL12B_P4
(Plasmid
#125724)
-
PurposeFor CRISPR-mediated epigenome editing of human IL12B gene locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 125724 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSPgRNA
-
Backbone manufacturer(Addgene #47108)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIL12B_P4_gRNA
-
Alt nameIL12B_LA44
-
gRNA/shRNA sequenceACACTAACGGTTTCTACACC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (not destroyed)
- 3′ cloning site BbsI (not destroyed)
- 5′ sequencing primer hU6-F
- 3′ sequencing primer T3
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSPgRNA_IL12B_P4 was a gift from Iouri Chepelev (Addgene plasmid # 125724)