Skip to main content

lentiCRISPR v2-sgBAP1-1
(Plasmid #125837)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 125837 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LentiCRISPR V2
  • Backbone manufacturer
    Feng Zhang
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BAP1 (BRCA1 associated protein 1)
  • gRNA/shRNA sequence
    CACCGACGAGCAGGGTGAAGAGGCC
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    25
  • Entrez Gene
    BAP1 (a.k.a. HUCEP-13, KURIS, TPDS1, UBM2, UCHL2, UVM2, hucep-6)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPR v2-sgBAP1-1 was a gift from Boyi Gan (Addgene plasmid # 125837 ; http://n2t.net/addgene:125837 ; RRID:Addgene_125837)
  • For your References section:

    BAP1 links metabolic regulation of ferroptosis to tumour suppression. Zhang Y, Shi J, Liu X, Feng L, Gong Z, Koppula P, Sirohi K, Li X, Wei Y, Lee H, Zhuang L, Chen G, Xiao ZD, Hung MC, Chen J, Huang P, Li W, Gan B. Nat Cell Biol. 2018 Oct;20(10):1181-1192. doi: 10.1038/s41556-018-0178-0. Epub 2018 Sep 10. 10.1038/s41556-018-0178-0 PubMed 30202049