Skip to main content

pTX1-SMN2-exon7-ESE1
(Plasmid #126042)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126042 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTX1 (pUC19 derived)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SMN2 exon7 ESE1
  • gRNA/shRNA sequence
    GCACCACACGGGUUUUAGACAAAAUCCG
  • Species
    H. sapiens (human), Synthetic

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTX1-SMN2-exon7-ESE1 was a gift from Frédéric Allain (Addgene plasmid # 126042 ; http://n2t.net/addgene:126042 ; RRID:Addgene_126042)
  • For your References section:

    Systems NMR: single-sample quantification of RNA, proteins and metabolites for biomolecular network analysis. Nikolaev Y, Ripin N, Soste M, Picotti P, Iber D, Allain FH. Nat Methods. 2019 Aug;16(8):743-749. doi: 10.1038/s41592-019-0495-7. Epub 2019 Jul 29. 10.1038/s41592-019-0495-7 PubMed 31363225