pTX1-SMN2-exon7-ESE1
(Plasmid
#126042)
-
PurposeIn-vitro-transcription of SMN2-exon7-ESE1 RNA in NMR tube for "Systems NMR" analysis
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126042 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTX1 (pUC19 derived)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSMN2 exon7 ESE1
-
gRNA/shRNA sequenceGCACCACACGGGUUUUAGACAAAAUCCG
-
SpeciesH. sapiens (human), Synthetic
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTX1-SMN2-exon7-ESE1 was a gift from Frédéric Allain (Addgene plasmid # 126042 ; http://n2t.net/addgene:126042 ; RRID:Addgene_126042) -
For your References section:
Systems NMR: single-sample quantification of RNA, proteins and metabolites for biomolecular network analysis. Nikolaev Y, Ripin N, Soste M, Picotti P, Iber D, Allain FH. Nat Methods. 2019 Aug;16(8):743-749. doi: 10.1038/s41592-019-0495-7. Epub 2019 Jul 29. 10.1038/s41592-019-0495-7 PubMed 31363225