pTEI127
(Plasmid
#126067)
-
PurposeModule 1 vector of PlaMiNGo toolkit for expression of mitochondria targeted GFP1-10 in plant cell
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126067 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepICH47742
- Total vector size (bp) 7487
-
Vector typePlant Expression ; Binary
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemitochondria Rieske iron sulphur protein (1-100 aa)
-
Alt namemtRi
-
SpeciesSolanum tuberosum
-
Insert Size (bp)969
-
GenBank IDX79332.1
- Promoter 'long' CaMV35S
-
Tag
/ Fusion Protein
- GFP1-10 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer ACGCTCGAGTATAAGAGCTC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTEI127 was a gift from Ralf-Bernd Klösgen (Addgene plasmid # 126067 ; http://n2t.net/addgene:126067 ; RRID:Addgene_126067) -
For your References section:
Targeting specificity of nuclear-encoded organelle proteins with a self-assembling split-fluorescent protein toolkit. Sharma M, Kretschmer C, Lampe C, Stuttmann J, Klosgen RB. J Cell Sci. 2019 Jun 3;132(11). pii: jcs.230839. doi: 10.1242/jcs.230839. 10.1242/jcs.230839 PubMed 31085714