pBbA19c-RFP
(Plasmid
#126109)
-
PurposeConstitutive expression vector for Escherichia coli. BglBrick compatible.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126109 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBb
- Backbone size w/o insert (bp) 2168
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRFP
-
SpeciesSynthetic
-
Insert Size (bp)678
- Promoter J23105
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGTAGTGATCTTATTTCATTATGGTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloning method was In-Fusion. Please note that a 1bp insertion following the CAT promoter was identified by Addgene's NGS result. The depositor noted that this discrepancy does NOT affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBbA19c-RFP was a gift from Nigel Scrutton (Addgene plasmid # 126109 ; http://n2t.net/addgene:126109 ; RRID:Addgene_126109) -
For your References section:
SelProm: A Queryable and Predictive Expression Vector Selection Tool for Escherichia coli. Jervis AJ, Carbonell P, Taylor S, Sung R, Dunstan MS, Robinson CJ, Breitling R, Takano E, Scrutton NS. ACS Synth Biol. 2019 Mar 18. doi: 10.1021/acssynbio.8b00399. 10.1021/acssynbio.8b00399 PubMed 30870592