pBbS18c-RFP
(Plasmid
#126201)
-
PurposeConstitutive expression vector for Escherichia coli. BglBrick compatible.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126201 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBb
- Backbone size w/o insert (bp) 3590
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGrow bacterial cultures in 20µM Chloramphenicol
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRFP
-
SpeciesSynthetic
-
Insert Size (bp)678
- Promoter J23117
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGTAGTGATCTTATTTCATTATGGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Grow bacterial cultures in 20 micromolar Chloramphenicol. Cloning method was In-Fusion.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBbS18c-RFP was a gift from Nigel Scrutton (Addgene plasmid # 126201 ; http://n2t.net/addgene:126201 ; RRID:Addgene_126201) -
For your References section:
SelProm: A Queryable and Predictive Expression Vector Selection Tool for Escherichia coli. Jervis AJ, Carbonell P, Taylor S, Sung R, Dunstan MS, Robinson CJ, Breitling R, Takano E, Scrutton NS. ACS Synth Biol. 2019 Mar 18. doi: 10.1021/acssynbio.8b00399. 10.1021/acssynbio.8b00399 PubMed 30870592