Skip to main content

MSCV-Syn-PSD95.FingR-eGFP
(Plasmid #126212)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126212 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMCSV
  • Backbone size w/o insert (bp) 6181
  • Total vector size (bp) 7231
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PSD95.FingR-eGFP
  • Insert Size (bp)
    1032
  • Promoter Synapsin

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGCGGTGGGCAGCGG
  • 3′ sequencing primer CCAGTCAATCTTTCACAAAT
  • (Common Sequencing Primers)

Resource Information

  • Addgene Notes
  • A portion of this plasmid was derived from a plasmid made by
    Part of this gene was derived from Addgene plasmid 46295 deposited by Don Arnold.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A duplication of the EGFP is present in the sequence, but the plasmid functions as described in the publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCV-Syn-PSD95.FingR-eGFP was a gift from Xue Han (Addgene plasmid # 126212 ; http://n2t.net/addgene:126212 ; RRID:Addgene_126212)
  • For your References section:

    A Viral Toolbox of Genetically Encoded Fluorescent Synaptic Tags. Bensussen S, Shankar S, Ching KH, Zemel D, Ta TL, Mount RA, Shroff SN, Gritton HJ, Fabris P, Vanbenschoten H, Beck C, Man HY, Han X. iScience. 2020 Jun 30;23(7):101330. doi: 10.1016/j.isci.2020.101330. 10.1016/j.isci.2020.101330 PubMed 32674057