Skip to main content

pTBL436 HEK293site3EQR sgRNA
(Plasmid #126445)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126445 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSQT1313
  • Backbone manufacturer
    Keith Joung
  • Backbone size w/o insert (bp) 2259
  • Total vector size (bp) 2279
  • Modifications to backbone
    The backbone was modified to express only one sgRNA.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    spacer against human HEK293 site3 with NGAG PAM
  • gRNA/shRNA sequence
    cagactgagcacgtgatggc
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Promoter human U6

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AGGGTTATTGTCTCATGAGCGG
  • 3′ sequencing primer CGGACAGGTATCCGGTAAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Keith Joung; the backbone was created from pSQT1313, Addgene #53370.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This construct was cloned by inverse PCR and in vivo recombination in E. coli strain SS320.

To integrate at HEK293 site 3, co-transfect with a homology donor (for example, pTBL405, Addgene #126442) and MSP680 from Keith Joung's group, Addgene #65772. Please visit https://doi.org/10.1101/639120 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTBL436 HEK293site3EQR sgRNA was a gift from Chang Liu (Addgene plasmid # 126445 ; http://n2t.net/addgene:126445 ; RRID:Addgene_126445)
  • For your References section:

    Lineage tracing and analog recording in mammalian cells by single-site DNA writing. Loveless TB, Grotts JH, Schechter MW, Forouzmand E, Carlson CK, Agahi BS, Liang G, Ficht M, Liu B, Xie X, Liu CC. Nat Chem Biol. 2021 Jun;17(6):739-747. doi: 10.1038/s41589-021-00769-8. Epub 2021 Mar 22. 10.1038/s41589-021-00769-8 PubMed 33753928