Skip to main content

pTBL649 CHYRON2 integration construct
(Plasmid #126446)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126446 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4146
  • Total vector size (bp) 6182
  • Modifications to backbone
    Added homology arms to target the insert to AAVS1.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    pU6-CHYRON2 hgRNA
  • Species
    H. sapiens (human); Streptococcus pyogenes
  • Insert Size (bp)
    465
  • Mutation
    The SpCas9 sgRNA constant region is mutated to make it self-targeting.
  • GenBank ID
  • Promoter human U6

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AAGGTCGGGCAGGAAGAGGG
  • 3′ sequencing primer TATGTAGAGAGGTACCTCGAGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    pCMV-puro
  • Alt name
    puromycin N-acetyltransferase
  • Species
    Streptomyces sp.
  • Insert Size (bp)
    1575
  • Promoter CMV

Cloning Information for Gene/Insert 2

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Keith Joung; the stgRNA expression cassette is from pSQT1313.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The mutations that make the sgRNA scaffold self-targeting or homing are described in Perli et al., 2016, doi: 10.1126/science.aag0511 and Kalhor et al., 2017, doi: 10.1038/nmeth.4108.

To integrate in human cells, digest with EcoRI and co-transfect with Addgene plasmids 126447 and 65772. Please visit https://doi.org/10.1101/639120 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTBL649 CHYRON2 integration construct was a gift from Chang Liu (Addgene plasmid # 126446 ; http://n2t.net/addgene:126446 ; RRID:Addgene_126446)
  • For your References section:

    Lineage tracing and analog recording in mammalian cells by single-site DNA writing. Loveless TB, Grotts JH, Schechter MW, Forouzmand E, Carlson CK, Agahi BS, Liang G, Ficht M, Liu B, Xie X, Liu CC. Nat Chem Biol. 2021 Jun;17(6):739-747. doi: 10.1038/s41589-021-00769-8. Epub 2021 Mar 22. 10.1038/s41589-021-00769-8 PubMed 33753928