pTBL472
(Plasmid
#126457)
-
PurposeExpresses Cas9-10xFlag-TdT in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5523
- Total vector size (bp) 11583
-
Modifications to backboneSwitched neomycin resistance to hygromycin.
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCas9
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4137
-
GenBank ID
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site KpnI now requires partial digest (not destroyed)
- 5′ sequencing primer CMV Forward
- 3′ sequencing primer ccggggtctcttcttccgagg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert name10x Flag
-
Insert Size (bp)360
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI now requires partial digest (not destroyed)
- 3′ cloning site FseI (not destroyed)
- 5′ sequencing primer GCAGCCTTCAAGTACTTCGACACC
- 3′ sequencing primer ccggggtctcttcttccgagg (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameTdT
-
Alt nameterminal deoxynucleotidyl transferase
-
Alt nameDNA nucleotidylexotransferase
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1530
-
GenBank IDNM_004088.3
-
Entrez GeneDNTT (a.k.a. TDT)
- Promoter CMV
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site FseI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GCAGCCTTCAAGTACTTCGACACC
- 3′ sequencing primer BGH Reverse (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGeorge Church; Cas9 is from Addgene plasmid 41815.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/639120 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTBL472 was a gift from Chang Liu (Addgene plasmid # 126457 ; http://n2t.net/addgene:126457 ; RRID:Addgene_126457) -
For your References section:
Lineage tracing and analog recording in mammalian cells by single-site DNA writing. Loveless TB, Grotts JH, Schechter MW, Forouzmand E, Carlson CK, Agahi BS, Liang G, Ficht M, Liu B, Xie X, Liu CC. Nat Chem Biol. 2021 Jun;17(6):739-747. doi: 10.1038/s41589-021-00769-8. Epub 2021 Mar 22. 10.1038/s41589-021-00769-8 PubMed 33753928