pET His10-Src42a
(Plasmid
#126674)
-
PurposeExpression of His10-Src42a for purification from E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126674 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSrc42a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET His10-Src42a was a gift from Ron Vale (Addgene plasmid # 126674 ; http://n2t.net/addgene:126674 ; RRID:Addgene_126674) -
For your References section:
Spatial control of Draper receptor signaling initiates apoptotic cell engulfment. Williamson AP, Vale RD. J Cell Biol. 2018 Nov 5;217(11):3977-3992. doi: 10.1083/jcb.201711175. Epub 2018 Aug 23. 10.1083/jcb.201711175 PubMed 30139739