pHAGE-hSPC-TFEB(delta30)eGFP-W
(Plasmid
#126693)
-
PurposeLineage specific over expression of a mutated TFEB in lung alveolar epithelial cells, where TFEB is missing the first 30 amino acids of the sequence.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126693 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHAGE
-
Backbone manufacturerDerived in Kotton lab
- Backbone size w/o insert (bp) 10685
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTFEB(delta30)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2097
-
MutationDeleted amino acids 1-30, H32D, Deleted Stop Codon on TFEB
-
Entrez GeneTFEB (a.k.a. ALPHATFEB, BHLHE35, TCFEB)
- Promoter hSPC
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CCTCTCCCTACGGACACAT
- 3′ sequencing primer GGAGCAACATAGTTAAGAATACCAGTCAATCTTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byShawn Ferguson (Addgene plasmid # 44445)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
GFP fused to 3' end of TFEB-detla30 insert
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE-hSPC-TFEB(delta30)eGFP-W was a gift from Darrell Kotton (Addgene plasmid # 126693 ; http://n2t.net/addgene:126693 ; RRID:Addgene_126693)