pET-FLAG-eSpCas9
(Plasmid
#126769)
-
PurposeExpression of increased fidelity eSpCas9 in bacterial cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126769 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMJ806-like
- Total vector size (bp) 10755
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeSpCas9
-
Alt nameeSpCas9 1.1
-
SpeciesS. pyogenes
-
Insert Size (bp)5457
-
MutationK848A, K1003A, R1060A
- Promoter T7
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on insert)
- NLS (N terminal on insert)
- NLS (C terminal on insert)
- MBP (N terminal on backbone)
- 6xHis (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BcuI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGGCGTACTGGTCGCCGATC
- 3′ sequencing primer TGCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pET-T7-6xHis-MBP-TEV-FLAG-NLS-eSpCas9-NLS
For detailed information and plasmid usage, please see the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-FLAG-eSpCas9 was a gift from Ervin Welker (Addgene plasmid # 126769 ; http://n2t.net/addgene:126769 ; RRID:Addgene_126769) -
For your References section:
Blackjack mutations improve the on-target activities of increased fidelity variants of SpCas9 with 5'G-extended sgRNAs. Kulcsar PI, Talas A, Toth E, Nyeste A, Ligeti Z, Welker Z, Welker E. Nat Commun. 2020 Mar 6;11(1):1223. doi: 10.1038/s41467-020-15021-5. 10.1038/s41467-020-15021-5 PubMed 32144253