Skip to main content

pET-FLAG-SpCas9-HF1
(Plasmid #126770)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126770 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMJ806-like
  • Total vector size (bp) 10755
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpCas9-HF1
  • Species
    S. pyogenes
  • Insert Size (bp)
    5457
  • Mutation
    N497A, R661A, Q695A, Q926A
  • Promoter T7
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)
    • MBP (N terminal on backbone)
    • 6xHis (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BcuI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGGCGTACTGGTCGCCGATC
  • 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pET-T7-6xHis-MBP-TEV-FLAG-NLS-SpCas9-HF1-NLS

For detailed information and plasmid usage, please see the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-FLAG-SpCas9-HF1 was a gift from Ervin Welker (Addgene plasmid # 126770 ; http://n2t.net/addgene:126770 ; RRID:Addgene_126770)
  • For your References section:

    Blackjack mutations improve the on-target activities of increased fidelity variants of SpCas9 with 5'G-extended sgRNAs. Kulcsar PI, Talas A, Toth E, Nyeste A, Ligeti Z, Welker Z, Welker E. Nat Commun. 2020 Mar 6;11(1):1223. doi: 10.1038/s41467-020-15021-5. 10.1038/s41467-020-15021-5 PubMed 32144253