Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pET-FLAG-B-eSpCas9
(Plasmid #126772)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 126772 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    B-eSpCas9
  • Alt name
    Blackjack-eSpCas9 1.1
  • Species
    S. pyogenes
  • Insert Size (bp)
    5436
  • Mutation
    K848A; K1003A; R1060A; amino acids 1005-1013 replaced with two glycine
  • Promoter T7
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)
    • MBP (N terminal on backbone)
    • 6xHis (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BcuI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGGCGTACTGGTCGCCGATC
  • 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

pET-T7-6xHis-MBP-TEV-FLAG-NLS-Blackjack-eSpCas9-NLS

Blackjack variants cleave both 20nt and 5'-extended 21nt spacer containing sgRNAs. B-eSpCas9 shows higher fidelity and target selectivity than its parental increased fidelity variant, eSpCas9.

For detailed information and plasmid usage, please see the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-FLAG-B-eSpCas9 was a gift from Ervin Welker (Addgene plasmid # 126772 ; http://n2t.net/addgene:126772 ; RRID:Addgene_126772)
  • For your References section:

    Blackjack mutations improve the on-target activities of increased fidelity variants of SpCas9 with 5'G-extended sgRNAs. Kulcsar PI, Talas A, Toth E, Nyeste A, Ligeti Z, Welker Z, Welker E. Nat Commun. 2020 Mar 6;11(1):1223. doi: 10.1038/s41467-020-15021-5. 10.1038/s41467-020-15021-5 PubMed 32144253