FLN-mEos2
(Plasmid
#126807)
-
Purposeexpress FLN fusion
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126807 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDXA-HY
-
Vector typeDictyostelium expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namefilamin-mEos2
-
Insert Size (bp)3249
-
Tag
/ Fusion Protein
- mEos2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CAGATTGCATAAAAAGATTTTTTTTTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FLN-mEos2 was a gift from David Knecht (Addgene plasmid # 126807 ; http://n2t.net/addgene:126807 ; RRID:Addgene_126807)