pre_IV_CS10_1033_v1
(Plasmid
#126860)
-
Purpose4x 1033 b long scaffolds divided by Zn-dependent self-cleaving DNAzyme cassettes, from compatibility group 10, made by method IV, yields linear 1033 b long scaffolds after Zn incubation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126860 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSB1A3
-
Backbone manufacturerIdem parts registry
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIV_CS10_1033_v1
-
SpeciesSynthetic
-
Insert Size (bp)1317
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer attaccgcctttgagtgagc
- 3′ sequencing primer tgccacctgacgtctaagaa
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Due to large repeated regions in the plasmid sequence, Addgene recommends verifying the plasmid by digest rather than sequencing.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pre_IV_CS10_1033_v1 was a gift from Hendrik Dietz (Addgene plasmid # 126860 ; http://n2t.net/addgene:126860 ; RRID:Addgene_126860) -
For your References section:
Custom-Size, Functional, and Durable DNA Origami with Design-Specific Scaffolds. Engelhardt FAS, Praetorius F, Wachauf CH, Bruggenthies G, Kohler F, Kick B, Kadletz KL, Pham PN, Behler KL, Gerling T, Dietz H. ACS Nano. 2019 Apr 22. doi: 10.1021/acsnano.9b01025. 10.1021/acsnano.9b01025 PubMed 30990672