Skip to main content

pre_IV_CS10_1033_v1
(Plasmid #126860)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126860 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSB1A3
  • Backbone manufacturer
    Idem parts registry
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IV_CS10_1033_v1
  • Species
    Synthetic
  • Insert Size (bp)
    1317

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer attaccgcctttgagtgagc
  • 3′ sequencing primer tgccacctgacgtctaagaa
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Due to large repeated regions in the plasmid sequence, Addgene recommends verifying the plasmid by digest rather than sequencing.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pre_IV_CS10_1033_v1 was a gift from Hendrik Dietz (Addgene plasmid # 126860 ; http://n2t.net/addgene:126860 ; RRID:Addgene_126860)
  • For your References section:

    Custom-Size, Functional, and Durable DNA Origami with Design-Specific Scaffolds. Engelhardt FAS, Praetorius F, Wachauf CH, Bruggenthies G, Kohler F, Kick B, Kadletz KL, Pham PN, Behler KL, Gerling T, Dietz H. ACS Nano. 2019 Apr 22. doi: 10.1021/acsnano.9b01025. 10.1021/acsnano.9b01025 PubMed 30990672