pRSFDuet1-Cdc45 (delta 154–164)
(Plasmid
#126879)
-
PurposeExpresses crystallisation construct of human Cdc45 in bacteria
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126879 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRSFDuet-1
- Backbone size w/o insert (bp) 3766
- Total vector size (bp) 5443
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman Cdc45
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1677
-
Mutationdeletion amino acid 154-164
-
Entrez GeneCDC45 (a.k.a. CDC45L, CDC45L2, MGORS7, PORC-PI-1)
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- No tag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TTGTACACGGCCGCATAATC
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis clone was already present before I joined the lab. But I have fully sequenced it to confirm.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSFDuet1-Cdc45 (delta 154–164) was a gift from Luca Pellegrini (Addgene plasmid # 126879 ; http://n2t.net/addgene:126879 ; RRID:Addgene_126879) -
For your References section:
Structure of human Cdc45 and implications for CMG helicase function. Simon AC, Sannino V, Costanzo V, Pellegrini L. Nat Commun. 2016 May 18;7:11638. doi: 10.1038/ncomms11638. 10.1038/ncomms11638 PubMed 27189187