-
PurposeExpression of immunoglobulin light chains in mammalian cells, mouse (C57BL/6), lambda 2 constant region
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127156 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 5729
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIglc2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)315
-
GenBank IDLR588434
-
Entrez GeneIglc2 (a.k.a. Igl-C2)
- Promoter hCMV IE1 gene promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site MscI (not destroyed)
- 5′ sequencing primer GCTTCGTTAGAACGCGGCTAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
ENA accession: LR588434, https://www.ebi.ac.uk/ena/browser/view/LR588434
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AbVec2.1-mIglc2 was a gift from Hedda Wardemann (Addgene plasmid # 127156 ; http://n2t.net/addgene:127156 ; RRID:Addgene_127156) -
For your References section:
ALDH4A1 is an atherosclerosis auto-antigen targeted by protective antibodies. Lorenzo C, Delgado P, Busse CE, Sanz-Bravo A, Martos-Folgado I, Bonzon-Kulichenko E, Ferrarini A, Gonzalez-Valdes IB, Mur SM, Roldan-Montero R, Martinez-Lopez D, Martin-Ventura JL, Vazquez J, Wardemann H, Ramiro AR. Nature. 2021 Jan;589(7841):287-292. doi: 10.1038/s41586-020-2993-2. Epub 2020 Dec 2. 10.1038/s41586-020-2993-2 PubMed 33268892