Skip to main content

AbVec2.0-mIgkc
(Plasmid #127157)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127157 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 5729
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Igkc
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    321
  • GenBank ID
    LR588433
  • Entrez Gene
    Igkc (a.k.a. Igk-C)
  • Promoter hCMV IE1 gene promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site PmlI (destroyed during cloning)
  • 5′ sequencing primer GCTTCGTTAGAACGCGGCTAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AbVec2.0-mIgkc was a gift from Hedda Wardemann (Addgene plasmid # 127157 ; http://n2t.net/addgene:127157 ; RRID:Addgene_127157)
  • For your References section:

    ALDH4A1 is an atherosclerosis auto-antigen targeted by protective antibodies. Lorenzo C, Delgado P, Busse CE, Sanz-Bravo A, Martos-Folgado I, Bonzon-Kulichenko E, Ferrarini A, Gonzalez-Valdes IB, Mur SM, Roldan-Montero R, Martinez-Lopez D, Martin-Ventura JL, Vazquez J, Wardemann H, Ramiro AR. Nature. 2021 Jan;589(7841):287-292. doi: 10.1038/s41586-020-2993-2. Epub 2020 Dec 2. 10.1038/s41586-020-2993-2 PubMed 33268892