PB-FLuc+GFPd2
(Plasmid #127190)

• Purpose: Piggybac transposon plasmid for expression of CMV promoter firefly luciferase (FLuc) and SV40 destabilized green fluorescent protein (GFPd2)
• Depositing Lab: Jordan Green
• Publication: Piggybac transposon plasmids (unpublished)

Backbone

• Vector backbone: PB-CAG-GAPd2
• Backbone size w/o insert (bp): 6466
• Total vector size (bp): 8174
• Modifications to backbone: Insertion of CMV-FLuc-bGH - SV40_prom to replace original CAG promoter of PB-GFPd2. Yields expression of firefly luciferase and destabilized GFPd2 driven by separate promoters.
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Firefly luciferase
• Alt name: FLuc
• Insert Size (bp): 1689
• GenBank ID: AAA89082
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: XmaI (not destroyed)
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg
• 3′ sequencing primer: CTGGTCGAGCTGGACGGCGACG

Resource Information

• Supplemental Documents:
  • pb-flucgfpd2-v2-confirmed.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry