Dom neg CstF64
(Plasmid
#127250)
-
PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127250 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEF1-myc/hisB
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 6200
-
Vector typeMammalian Expression ; Other
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCstF64 delta 282
-
Alt nameCM561
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1700
-
Mutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTACGCTGCTAGT; lacks the last 282 amino acids
-
Entrez GeneCSTF2 (a.k.a. CstF-64)
- Promoter pEF1a
Cloning Information
- Cloning method Unknown
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Removal of the last 282 aa makes a dominant negative. This plasmid was derived from Addgene Plasmid 127251.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Dom neg CstF64 was a gift from Christine Milcarek (Addgene plasmid # 127250 ; http://n2t.net/addgene:127250 ; RRID:Addgene_127250) -
For your References section:
Transcription elongation factor ELL2 directs immunoglobulin secretion in plasma cells by stimulating altered RNA processing. Martincic K, Alkan SA, Cheatle A, Borghesi L, Milcarek C. Nat Immunol. 2009 Oct;10(10):1102-9. doi: 10.1038/ni.1786. Epub 2009 Sep 13. 10.1038/ni.1786 PubMed 19749764