pcDNA3.1(+)/(CAA)12 + (AGAGAG)7 5′ leader AUG-nLuc-3XFLAG
(Plasmid
#127326)
-
PurposeExpress 3xFLAG tagged nanoLuciferase (nLuc) from AUG start codon from mRNA with (AGAGAG)7 repeats in 5' UTR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127326 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1(+)
- Total vector size (bp) 5994
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenanoLuciferase
-
Alt namenLuc
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1(+)/(CAA)12 + (AGAGAG)7 5′ leader AUG-nLuc-3XFLAG was a gift from Jeremy Wilusz (Addgene plasmid # 127326 ; http://n2t.net/addgene:127326 ; RRID:Addgene_127326) -
For your References section:
Ribosome queuing enables non-AUG translation to be resistant to multiple protein synthesis inhibitors. Kearse MG, Goldman DH, Choi J, Nwaezeapu C, Liang D, Green KM, Goldstrohm AC, Todd PK, Green R, Wilusz JE. Genes Dev. 2019 Jun 6. pii: gad.324715.119. doi: 10.1101/gad.324715.119. 10.1101/gad.324715.119 PubMed 31171704