Skip to main content

pcDNA3.1(+)/BAG1 5′ UTR AUG-nLuc-3xFLAG
(Plasmid #127329)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127329 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Total vector size (bp) 5998
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nanoLuciferase
  • Alt name
    nLuc
  • Promoter CMV
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1(+)/BAG1 5′ UTR AUG-nLuc-3xFLAG was a gift from Jeremy Wilusz (Addgene plasmid # 127329 ; http://n2t.net/addgene:127329 ; RRID:Addgene_127329)
  • For your References section:

    Ribosome queuing enables non-AUG translation to be resistant to multiple protein synthesis inhibitors. Kearse MG, Goldman DH, Choi J, Nwaezeapu C, Liang D, Green KM, Goldstrohm AC, Todd PK, Green R, Wilusz JE. Genes Dev. 2019 Jun 6. pii: gad.324715.119. doi: 10.1101/gad.324715.119. 10.1101/gad.324715.119 PubMed 31171704