PB-Neo-TetO-Cdk13_Untagged
(Plasmid
#127344)
-
PurposeUntagged mouse Cdk13 transgene (NP_001074527.1 isoform) cloned into a dox-inducible piggybac destination vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127344 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePBNeo-TetO-Dest
-
Backbone manufacturerAlbert Cheng (Jackson Labs)
- Backbone size w/o insert (bp) 10369
- Total vector size (bp) 13304
-
Modifications to backboneNone
-
Vector typeMammalian Expression ; Piggybac Transposase Vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCyclin Dependent Kinase 13
-
Alt nameCdk13
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)4563
-
MutationBase pairs 1-1554 of transgene are codon optimized to reduce GC content
-
GenBank IDNP_001074527.1
-
Entrez GeneCdk13 (a.k.a. 2310015O17Rik, Cdc2l5)
- Promoter TetO Promoter
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer atccacgctgttttgacctc
- 3′ sequencing primer agaccgaggagagggttagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/824193 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-Neo-TetO-Cdk13_Untagged was a gift from Phil Sharp (Addgene plasmid # 127344 ; http://n2t.net/addgene:127344 ; RRID:Addgene_127344) -
For your References section:
Oncogenic CDK13 mutations impede nuclear RNA surveillance. Insco ML, Abraham BJ, Dubbury SJ, Kaltheuner IH, Dust S, Wu C, Chen KY, Liu D, Bellaousov S, Cox AM, Martin BJE, Zhang T, Ludwig CG, Fabo T, Modhurima R, Esgdaille DE, Henriques T, Brown KM, Chanock SJ, Geyer M, Adelman K, Sharp PA, Young RA, Boutz PL, Zon LI. Science. 2023 Apr 21;380(6642):eabn7625. doi: 10.1126/science.abn7625. Epub 2023 Apr 21. 10.1126/science.abn7625 PubMed 37079685