Skip to main content

PB-Neo-TetO-Cdk13_Untagged
(Plasmid #127344)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127344 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PBNeo-TetO-Dest
  • Backbone manufacturer
    Albert Cheng (Jackson Labs)
  • Backbone size w/o insert (bp) 10369
  • Total vector size (bp) 13304
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression ; Piggybac Transposase Vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cyclin Dependent Kinase 13
  • Alt name
    Cdk13
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    4563
  • Mutation
    Base pairs 1-1554 of transgene are codon optimized to reduce GC content
  • GenBank ID
    NP_001074527.1
  • Entrez Gene
    Cdk13 (a.k.a. 2310015O17Rik, Cdc2l5)
  • Promoter TetO Promoter
  • Tag / Fusion Protein
    • None

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer atccacgctgttttgacctc
  • 3′ sequencing primer agaccgaggagagggttagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/824193 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-Neo-TetO-Cdk13_Untagged was a gift from Phil Sharp (Addgene plasmid # 127344 ; http://n2t.net/addgene:127344 ; RRID:Addgene_127344)
  • For your References section:

    Oncogenic CDK13 mutations impede nuclear RNA surveillance. Insco ML, Abraham BJ, Dubbury SJ, Kaltheuner IH, Dust S, Wu C, Chen KY, Liu D, Bellaousov S, Cox AM, Martin BJE, Zhang T, Ludwig CG, Fabo T, Modhurima R, Esgdaille DE, Henriques T, Brown KM, Chanock SJ, Geyer M, Adelman K, Sharp PA, Young RA, Boutz PL, Zon LI. Science. 2023 Apr 21;380(6642):eabn7625. doi: 10.1126/science.abn7625. Epub 2023 Apr 21. 10.1126/science.abn7625 PubMed 37079685