Skip to main content

pART15-C1
(Plasmid #127395)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127395 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    None
  • Total vector size (bp) 5877
  • Modifications to backbone
    p15A origin of replication and AmpR amplified from pACYC177 were cloned with tetR from pKLiO20 and the araC, PBAD promoter and the T1T2 terminators from pBAD24 using Gibson cloning. PLtetO-1 promoter from pKLiO30 was cloned using Gibson cloning. AmCyan fluorescent gene, amplified from pAmCyan was cloned downstream of PBAD promoter.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    E.coli 10 beta
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    AmCyan
  • Species
    Synthetic
  • Insert Size (bp)
    690
  • GenBank ID
    ALQ43923.1
  • Promoter PBAD

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGGCTCTTTCAAACAAGTTTATC
  • 3′ sequencing primer TCAGAAAGGGACAACAGAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is used to test the effect of small regualtory RNAs on the expression of amcyan gene.
amcyan gene is under the control of PBAD promoter.
No sRNA downstrean of PLtetO-1 promoter.

Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pART15-C1 was a gift from Ryan Senger (Addgene plasmid # 127395 ; http://n2t.net/addgene:127395 ; RRID:Addgene_127395)
  • For your References section:

    A novel synthetic sRNA promoting protein overexpression in cell-free systems. Tanniche I, Nazem-Bokaee H, Scherr DM, Schlemmer S, Senger RS. Biotechnol Prog. 2023 May-Jun;39(3):e3324. doi: 10.1002/btpr.3324. Epub 2023 Feb 15. 10.1002/btpr.3324 PubMed 36651906