Skip to main content

FLAG-MBP1-K295TAG-W340A-CAAX.pcDNA3-k
(Plasmid #127399)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127399 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5370
  • Total vector size (bp) 6711
  • Modifications to backbone
    Addition of Kozak Sequence
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Maltose Binding Protein
  • Alt name
    MBP
  • Insert Size (bp)
    1341
  • Mutation
    Amino acid mutations: K295 to Amber codon and W340A
  • Promoter CMV
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • CAAX (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Hind III (not destroyed)
  • 3′ cloning site Not I (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GACAGTGGGAGTGGCACCTT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The amino acid sequence of MBP was based on the pMAL-c5x vector (New England Biolabs) and was codon optimized for mammalian cell expression.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

W340A was introduced to reduce the affinity of MBP for endogenous ligands.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FLAG-MBP1-K295TAG-W340A-CAAX.pcDNA3-k was a gift from Sharona Gordon (Addgene plasmid # 127399 ; http://n2t.net/addgene:127399 ; RRID:Addgene_127399)
  • For your References section:

    Visualizing conformational dynamics of proteins in solution and at the cell membrane. Gordon SE, Munari M, Zagotta WN. Elife. 2018 Jun 20;7. pii: 37248. doi: 10.7554/eLife.37248. 37248 [pii] PubMed 29923827