-
PurposeEncodes YhaV toxin. CAM-R
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127446 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDS132
- Total vector size (bp) 6034
-
Modifications to backboneExtensive - see paper for details
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Growth instructionsNEEDS 2% GLUCOSE
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameyhaV toxin
- Promoter pRha
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tcatctttccctggttgcca
- 3′ sequencing primer tcaaacatgagaattcgcgga
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySwaine Chen lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTOX1 was a gift from Matthew Waldor (Addgene plasmid # 127446 ; http://n2t.net/addgene:127446 ; RRID:Addgene_127446) -
For your References section:
A New Suite of Allelic Exchange Vectors for the Scarless Modification of Proteobacterial Genomes. Lazarus JE, Warr AR, Kuehl CJ, Giorgio RT, Davis BM, Waldor MK. Appl Environ Microbiol. 2019 Jun 14. pii: AEM.00990-19. doi: 10.1128/AEM.00990-19. 10.1128/AEM.00990-19 PubMed 31201277