Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #127451)


Item Catalog # Description Quantity Price (USD)
Plasmid 127451 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Total vector size (bp) 6837
  • Modifications to backbone
    Extensive - see paper for details
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
  • Copy number

Gene/Insert 1

  • Gene/Insert name
    tse2 toxin
  • Promoter pRha

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tcatctttccctggttgcca
  • 3′ sequencing primer tcaaacatgagaattcgcgga
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    amilCP chromoprotein
  • Mutation
    Codon optimized from protein sequence in FPbase
  • Promoter tac

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer atgtgtggaaaggcggttca
  • 3′ sequencing primer AGATCCTTGGCGGCAAGAAA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Swaine Chen lab

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTOX6 was a gift from Matthew Waldor (Addgene plasmid # 127451 ; ; RRID:Addgene_127451)
  • For your References section:

    A New Suite of Allelic Exchange Vectors for the Scarless Modification of Proteobacterial Genomes. Lazarus JE, Warr AR, Kuehl CJ, Giorgio RT, Davis BM, Waldor MK. Appl Environ Microbiol. 2019 Jun 14. pii: AEM.00990-19. doi: 10.1128/AEM.00990-19. 10.1128/AEM.00990-19 PubMed 31201277