pAVA-Gal11p-LGF2(fs)
(Plasmid #127482)

• Purpose: Negative control for the AVA-seq system. Gal11p (lambda CI associated) and LGF2 (with one nucleotide insertion) (RNAp associated) interaction
• Depositing Lab: Joel Malek
• Publication: Andrews et al J Biol Chem. 2019 Jul 26;294(30):11549-11558. doi: 10.1074/jbc.RA119.008792. Epub 2019 Jun 10.

Backbone

• Vector backbone: pBT
• Backbone manufacturer: Agilent #240067
• Modifications to backbone: inserted AD domain of pTRG (Agilent #240066) adjacent but convergent to the DBD
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: The Malek lab recommends using BacterioMatch II Validation Reporter Competent Cells (Catalog #200192) for downstream applications.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Gal11p-LGF2(frame shifted)
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 420
• Mutation: LGF2 is frame shifted by the insert of one nucleotide between LGF2 and RNAp
• Entrez Gene: GAL11 (a.k.a. YOL051W, ABE1, MED15, RAR3, SDS4, SPT13)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BstX1 (not destroyed)
• 3′ cloning site: BstX1 (not destroyed)
• 5′ sequencing primer: TCCGTTGTGGGGAAAGTTATC
• 3′ sequencing primer: AGCTTCCAGTTGTTCAGCCA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry