Skip to main content

Sox2-t2A-GFP
(Plasmid #127537)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127537 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 127537-D50 50 μg of DNA in Tris buffer $495
DNA 127537-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3.3-TOPO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 6150
  • Total vector size (bp) 7104
  • Modifications to backbone
    Inserted T2a-eGFP at 3' terminal of MCS.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SOX2
  • Alt name
    ANOP3
  • Alt name
    MCOPS3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    954
  • GenBank ID
    NM_003106
  • Entrez Gene
    SOX2 (a.k.a. ANOP3, MCOPS3)
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer cgtcgccgtccagctcgaccag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    SOX2 was subcloned from Harvard Institute of Proteomics (HsCD00079917)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Sox2-t2A-GFP was a gift from Jennifer Mitchell (Addgene plasmid # 127537 ; http://n2t.net/addgene:127537 ; RRID:Addgene_127537)
  • For your References section:

    KLF4 protein stability regulated by interaction with pluripotency transcription factors overrides transcriptional control. Dhaliwal NK, Abatti LE, Mitchell JA. Genes Dev. 2019 Jun 20. pii: gad.324319.119. doi: 10.1101/gad.324319.119. 10.1101/gad.324319.119 PubMed 31221664