Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Sox2-t2A-mCherry
(Plasmid #127538)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 127538 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.3-TOPO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 6150
  • Total vector size (bp) 7104
  • Modifications to backbone
    Inserted T2a-mCherry at 3' terminal of MCS.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SOX2
  • Alt name
    ANOP3
  • Alt name
    MCOPS3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    954
  • GenBank ID
    NM_003106
  • Entrez Gene
    SOX2 (a.k.a. ANOP3, MCOPS3)
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TTGGTCACCTTCAGCTTGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    SOX2 was subcloned from Harvard Institute of Proteomics (HsCD00079917)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Sox2-t2A-mCherry was a gift from Jennifer Mitchell (Addgene plasmid # 127538 ; http://n2t.net/addgene:127538 ; RRID:Addgene_127538)
  • For your References section:

    KLF4 protein stability regulated by interaction with pluripotency transcription factors overrides transcriptional control. Dhaliwal NK, Abatti LE, Mitchell JA. Genes Dev. 2019 Jun 20. pii: gad.324319.119. doi: 10.1101/gad.324319.119. 10.1101/gad.324319.119 PubMed 31221664