Nanog-t2A-mCherry
(Plasmid
#127541)
-
PurposeExpresses the transactivation domain of mouse Nanog and mCherry via t2A linker.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127541 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.3-TOPO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 6149
- Total vector size (bp) 8149
-
Modifications to backboneInserted T2a-mCherry at 3' terminal of MCS.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNanog
-
Alt nameENK
-
Alt nameecat4
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2000
-
MutationCodes for the last 110 a.a of Nanog
-
GenBank IDNM_001289830
-
Entrez GeneNanog (a.k.a. 2410002E02Rik, ENK, Stm1, ecat4)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TTGGTCACCTTCAGCTTGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byNanog was subcloned from Addgene plasmid # 59994.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid codes for the activation domain of mouse Nanog (last 110 a.a).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Nanog-t2A-mCherry was a gift from Jennifer Mitchell (Addgene plasmid # 127541 ; http://n2t.net/addgene:127541 ; RRID:Addgene_127541) -
For your References section:
KLF4 protein stability regulated by interaction with pluripotency transcription factors overrides transcriptional control. Dhaliwal NK, Abatti LE, Mitchell JA. Genes Dev. 2019 Jun 20. pii: gad.324319.119. doi: 10.1101/gad.324319.119. 10.1101/gad.324319.119 PubMed 31221664