-
PurposeKnock-down of human STING
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127647 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLKO.1
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSTING shRNA
-
gRNA/shRNA sequenceGCCCGGATTCGAACTTACAATCTCGAGATTGTAAGTTCGAATCCGGGC
-
SpeciesH. sapiens (human)
-
Entrez GeneSTING1 (a.k.a. ERIS, MITA, MPYS, NET23, SAVI, STING, STING-beta, TMEM173, hMITA, hSTING)
Cloning Information
- Cloning method Unknown
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-puro-STING-sh5 was a gift from Nicolas Manel (Addgene plasmid # 127647 ; http://n2t.net/addgene:127647 ; RRID:Addgene_127647) -
For your References section:
Bloom syndrome protein restrains innate immune sensing of micronuclei by cGAS. Gratia M, Rodero MP, Conrad C, Bou Samra E, Maurin M, Rice GI, Duffy D, Revy P, Petit F, Dale RC, Crow YJ, Amor-Gueret M, Manel N. J Exp Med. 2019 May 6;216(5):1199-1213. doi: 10.1084/jem.20181329. Epub 2019 Apr 1. 10.1084/jem.20181329 PubMed 30936263