pEMY07AB-PRO
(Plasmid
#127710)
-
Purpose(Empty Backbone) Level 0 destination vector for a promoter with A - B scars. Clone in with BpiI
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127710 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEMY07
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CAGACAAGCCCGTCAGG
- 3′ sequencing primer GTTATCCCCTGATTCTGTGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
LacZ inside of BpiI sites for blue/white screening of clones. A scar is GTGC and B scar is AATG.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEMY07AB-PRO was a gift from Christopher Voigt (Addgene plasmid # 127710 ; http://n2t.net/addgene:127710 ; RRID:Addgene_127710) -
For your References section:
Iterative algorithm-guided design of massive strain libraries, applied to itaconic acid production in yeast. Young EM, Zhao Z, Gielesen BEM, Wu L, Benjamin Gordon D, Roubos JA, Voigt CA. Metab Eng. 2018 Jul;48:33-43. doi: 10.1016/j.ymben.2018.05.002. Epub 2018 May 9. 10.1016/j.ymben.2018.05.002 PubMed 29753070