pY128
(Plasmid
#127713)
-
Purpose(Empty Backbone) Level 1 yeast shuttle vector for a transcription unit with A - D scars. Clone in with BsaI. Has a high-copy yeast replicon and KanMX selection.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127713 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEMY11
-
Vector typeYeast Expression, Synthetic Biology
-
Selectable markersG418
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GTTATCCCCTGATTCTGTGG
- 3′ sequencing primer ATTCAGCAATTTGCCCG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
High copy yeast shuttle vector compatible with TypeIIS assembly (GoldenGate or MoClo). A scar is GTGC and D scar is CCTC. LacZ cassette for blue/white screening of clones.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pY128 was a gift from Christopher Voigt (Addgene plasmid # 127713 ; http://n2t.net/addgene:127713 ; RRID:Addgene_127713) -
For your References section:
Iterative algorithm-guided design of massive strain libraries, applied to itaconic acid production in yeast. Young EM, Zhao Z, Gielesen BEM, Wu L, Benjamin Gordon D, Roubos JA, Voigt CA. Metab Eng. 2018 Jul;48:33-43. doi: 10.1016/j.ymben.2018.05.002. Epub 2018 May 9. 10.1016/j.ymben.2018.05.002 PubMed 29753070