pDSM-bc-Ptdh3-CAD-Ttdh1
(Plasmid
#127727)
-
PurposeYeast pathway position 3. CAD transcription unit with the TDH3 promoter and TDH1 terminator.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127727 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDSM-bc
-
Vector typeYeast Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecis-aconitate decarboxylase
-
Alt nameCAD
-
SpeciesAspergillus terreus
-
Insert Size (bp)1495
-
GenBank IDMH366503.1
- Promoter Ptdh3
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer CGGATCGATGTACACAACCG
- 3′ sequencing primer CAACAGGAGGCGGATGGATATAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CAD transcription unit with pathway position 3 homology arms, compatible with 5' position 2 and 3' position 3 homology arm. Sequencing primers are also the primers for amplifying DNA for integration into the S. cerevisiae genome.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDSM-bc-Ptdh3-CAD-Ttdh1 was a gift from Christopher Voigt (Addgene plasmid # 127727 ; http://n2t.net/addgene:127727 ; RRID:Addgene_127727) -
For your References section:
Iterative algorithm-guided design of massive strain libraries, applied to itaconic acid production in yeast. Young EM, Zhao Z, Gielesen BEM, Wu L, Benjamin Gordon D, Roubos JA, Voigt CA. Metab Eng. 2018 Jul;48:33-43. doi: 10.1016/j.ymben.2018.05.002. Epub 2018 May 9. 10.1016/j.ymben.2018.05.002 PubMed 29753070