pDSM-cd-Pfba1p-ACO-Tgpm1
(Plasmid
#127731)
-
PurposeYeast pathway position 4. ACO transcription unit with the FBA1 promoter and GPM1 terminator.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127731 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDSM-cd
-
Vector typeYeast Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameaconitase
-
Alt nameACO1
-
Alt nameACO
-
SpeciesS. cerevisiae (budding yeast), Synthetic
-
Insert Size (bp)2305
-
GenBank IDMH366501.1
- Promoter Pfba1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer ACGCTTTCCGGCATCTTCCAG
- 3′ sequencing primer GCGGAATATTGGCGGAACGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
ACO transcription unit with pathway position 4 homology arms, compatible with 5' position 3 and 3' position 5 homology arm. Sequencing primers are also the primers for amplifying DNA for integration into the S. cerevisiae genome.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDSM-cd-Pfba1p-ACO-Tgpm1 was a gift from Christopher Voigt (Addgene plasmid # 127731 ; http://n2t.net/addgene:127731 ; RRID:Addgene_127731) -
For your References section:
Iterative algorithm-guided design of massive strain libraries, applied to itaconic acid production in yeast. Young EM, Zhao Z, Gielesen BEM, Wu L, Benjamin Gordon D, Roubos JA, Voigt CA. Metab Eng. 2018 Jul;48:33-43. doi: 10.1016/j.ymben.2018.05.002. Epub 2018 May 9. 10.1016/j.ymben.2018.05.002 PubMed 29753070