pU6-Sox3gRNA-T2
(Plasmid
#127778)
-
PurposeChicken sox3 gRNA target site 2, cloned into the pU6 sgRNA (backbone #92359)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127778 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepU6
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesox3gRNAT2
-
Alt namesgRNA seq- TCTGCGCCGTGGACATCATG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmB1 (destroyed during cloning)
- 3′ cloning site BsmB1 (destroyed during cloning)
- 5′ sequencing primer -
- 3′ sequencing primer - (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-Sox3gRNA-T2 was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 127778 ; http://n2t.net/addgene:127778 ; RRID:Addgene_127778) -
For your References section:
Early chromatin shaping predetermines multipotent vagal neural crest into neural, neuronal and mesenchymal lineages. Ling ITC, Sauka-Spengler T. Nat Cell Biol. 2019 Dec;21(12):1504-1517. doi: 10.1038/s41556-019-0428-9. Epub 2019 Dec 2. 10.1038/s41556-019-0428-9 PubMed 31792380